RegulonDB RegulonDB 10.8: Gene Sequence
xapR gene sequence


Size: 885        A: 210  T: 228  G: 242  C: 205

Fasta

 

>xapR E. coli K12. Version NC_000913.3 GI:556503834
atggaacgcgtatacagaacagatcttaagttgctccgttattttcttgccgtagcggaa
gagttgcattttggccgcgcagcagcgcgtttaaatatgtctcagcctccgctcagcatt
catattaaagagctggaaaatcaactcggcacgcagctttttattcgccattcgcgcagc
gtcgtactgacacacgcgggcaaaatcttgatggaagaatcgcgtcgattgctggtgaat
gctaataatgtattggctcggattgaacaaataggtcggggagaagcagggcggattgaa
ctcggcgtagtgggaacggcaatgtggggacggatgcgcccggttatgcggcgattcctc
agggaaaatcctaacgttgacgttctttttcgcgaaaagatgcccgcgatgcaaatggcc
ttgctggaacgccgcgaacttgatgccgggatctggcgaatggcgacagaaccaccgact
ggttttaccagcttacggttgcatgaatcggcgtttctggtggcgatgcctgaagagcat
catctctcatcattttccaccgtcccgctggaagcgctacgtgacgagtattttgttaca
atgccgcccgtttacactgactgggattttttgcagcgagtttgccagcaggtgggattt
tcaccggttgttattcgcgaagttaatgaaccgcaaacggtactcgctatggtcagtatg
ggcattggtatcacattgatagcggacagctacgcacaaatgaactggccaggtgtcatt
ttccgtccgctcaaacagcgcatccctgcagatttatatattgtttatgaaacacagcag
gtgacgcccgcgatggttaagctgttggctgcattgacacagtag
              
                            

Download fasta file
RegulonDB