RegulonDB RegulonDB 10.9: Gene Sequence
gcvR gene sequence


Size: 573        A: 144  T: 142  G: 143  C: 144

Fasta

 

>gcvR E. coli K12. Version NC_000913.3 GI:556503834
ttgacactgtcatcgcaacattatctggtgatcactgcgttgggtgccgatcgccctgga
attgtgaacaccatcacccgtcatgtcagtagttgcggctgtaatattgaagacagtcgc
ctggcgatgctgggagaagagttcacgtttattatgctgctttccggttcatggaatgcc
attactctgattgaatcaacgttaccgttgaaaggtgccgaactggatcttttaatcgtg
atgaagcgcacgacggcgcgtccgcgtccgccaatgccagcatctgtctgggttcaggtc
gatgtggcagactccccgcatttaattgaacgcttcacagcacttttcgacgcgcatcat
atgaacattgcggagctggtgtcgcgcacgcaacctgctgaaaatgaacgggctgcgcag
ttgcatattcagataaccgcccacagccccgcatctgcggacgcagcaaatattgagcaa
gcgttcaaagccctatgtacagaactcaatgcacaaggcagtattaacgtcgtcaattat
tcccaacatgatgaacaggatggagttaagtaa
              
                            

Download fasta file
RegulonDB