RegulonDB RegulonDB 10.9: Gene Sequence
hyfA gene sequence


Size: 618        A: 136  T: 134  G: 170  C: 178

Fasta

 

>hyfA E. coli K12. Version NC_000913.3 GI:556503834
atgaaccgctttgtggtggccgaaccactgtggtgtacaggatgtaatacctgtctcgct
gcctgttcggacgtgcataaaacgcaaggtttacagcaacacccgcgcctggccctggcg
aagacgtcaacaatcactgcccctgtcgtgtgtcatcactgtgaggaagccccttgcctg
caggtctgcccggtcaatgccatctctcagagggatgatgcgatccaactcaacgaaagc
ctctgtattggctgcaagctttgcgccgtggtctgcccatttggcgcaatcagcgcttca
ggaagccgtccggtgaatgcccatgcgcaatatgtttttcaggctgaaggctcactcaaa
gacggcgaagaaaacgcgccaacacaacatgctttgctgcgctgggaacctggtgtccag
accgtcgcggtgaaatgcgacctgtgtgatttcttgccagaaggtccggcctgcgttcgc
gcttgcccgaatcaggcgttacggctgatcaccggtgatagcctgcaacgtcagatgaaa
gaaaaacagcgccttgccgcaagctggtttgccaatggcggggaggatcccctttccctc
actcaggagcaacgctaa
              
                            

Download fasta file
RegulonDB