RegulonDB RegulonDB 10.9: Gene Sequence
yfiB gene sequence


Size: 483        A: 136  T: 100  G: 115  C: 132

Fasta

 

>yfiB E. coli K12. Version NC_000913.3 GI:556503834
atgataaagcacctggtagcacccctggttttcacctcactaatactgactggctgccag
tcccctcagggaaagtttactcctgagcaagtcgccgctatgcaatcttatggatttact
gaatccgccggcgactggtcgctgggcttatcagatgccattctgttcgcaaaaaatgac
tacaaattgctcccggaaagccagcaacagatccaaaccatggcagctaaattggcctcg
acagggctaacacatgcccgtatggatggacacaccgataactatggtgaagacagttac
aacgaaggcttatcattgaaacgggcgaatgtcgtggccgatgcatgggctatgggtgga
caaattccacgcagcaatctcaccacacagggtttaggaaaaaaatatcccatagccagt
aacaagaccgcccagggccgcgccgagaaccgccgcgtcgcagtggtgattactacccct
taa
              
                            

Download fasta file
RegulonDB