RegulonDB RegulonDB 10.9: Gene Sequence
rimM gene sequence


Size: 549        A: 145  T: 135  G: 148  C: 121

Fasta

 

>rimM E. coli K12. Version NC_000913.3 GI:556503834
atgagcaaacaactcaccgcgcaagcacctgttgatcccatcgttttgggaaaaatgggt
tcgtcttacggtattcgtgggtggctcagagtgttttcttccaccgaagacgccgaaagc
atttttgactatcagccctggtttatccagaaggcgggtcagtggcagcaagtccagctg
gaaagctggaagcaccacaatcaggacatgatcatcaagctgaaaggcgttgacgatcgt
gatgcggcgaacctgctgacgaattgtgaaattgtcgtggattcatcgcagctgcctcag
cttgaagagggggactactactggaaagacctgatgggctgccaggtagtaaccactgaa
ggctacgatctcggtaaagtcgtcgatatgatggaaaccggatctaatgacgttctcgtc
attaaggcaaacctgaaagatgcgtttggtatcaaggaacgtctcgtaccgttcctcgat
gggcaggttatcaagaaagtcgatctcactactcgttcaatcgaagtagattgggatcct
ggtttttaa
              
                            

Download fasta file
RegulonDB