RegulonDB RegulonDB 10.9: Gene Sequence
ppdC gene sequence


Size: 324        A: 78  T: 68  G: 94  C: 84

Fasta

 

>ppdC E. coli K12. Version NC_000913.3 GI:556503834
atgtcagcttccctgaagaatcaacaaggctttagcctgccggaggtaatgttggcgatg
gtgttgatggtgatgattgtcactgcgttatcgggtttccagcgaacattaatgaacagt
cttgccagcagaaaccagtaccaacagctctggcggcatggctggcagcaaacgcaactg
cgcgcgatttcgccacctgccaactggcaggtcaaccgaatgcagacatcgcaggcggga
tgtgtcagcatcagcgttacgctagtttcacccgggggcagagaaggcgagatgacccgc
ctgcattgcccgaatcgtcagtag
              
                            

Download fasta file
RegulonDB