RegulonDB RegulonDB 10.9: Gene Sequence
ygdB gene sequence


Size: 408        A: 84  T: 109  G: 125  C: 90

Fasta

 

>ygdB E. coli K12. Version NC_000913.3 GI:556503834
gtgaaccgcgaaaagggtgtttcgtcactggctctggtcctgatgctgctggttttgggt
agtttgctattacaaggaatgagccaacaggatcgcagttttgcctctcgcgtgagcatg
gaaagtcagtcattgcgccgccaggccatcgttcagtcggcgctggcgtggggaaaaatg
cactgctggcagacgcagccagcagttcagtgctcgcagtacgctgaaaccgatgcccag
gtttgtttgcgtttactggcagataatgaagccttattgattgccggttatgaaggcgtt
tcgttgtggcgaacaggcgaagtcattgatggaaacattgttttttcgccacgcggctgg
agcgatttttgtccgctgaaagagagggcgttatgtcagcttccctga
              
                            

Download fasta file
RegulonDB