RegulonDB RegulonDB 10.9: Gene Sequence
ppdB gene sequence


Size: 564        A: 129  T: 140  G: 177  C: 118

Fasta

 

>ppdB E. coli K12. Version NC_000913.3 GI:556503834
atgcctgtaaaagagcaaggtttttctctgctggaagtgttgattgctatggcgatcagt
agcgtattgttgctgggggcggcacgctttctgcctgcgttacagcgtgaaagtttaacg
agcacccgtaagctggcgctggaagatgaaatctggctgcgggtatttaccgtcgcgaag
catctccagagggcgggttattgtcatggcatctgtaccggcgaagggctggaaattgtc
ggacagggtgactgtgtcattgtgcagtgggatgcgaacagtaacggtatctgggatcgc
gaaccggtaaaagagtccgaccagattggatttcgtctgaaggagcatgtgctggaaacg
ctacgcggtgcgacatcctgtgaaggtaagggctgggataaagtcactaatccggatgcc
atcattatcgacacttttcaggtcgtacgtcaggatgtcagcggcttctcgccggtgttg
acggttaatatgcgtgctgccagtaagtctgaaccgcaaaccgtggtgaatgccagctat
agcgtgacaggattcaacctgtga
              
                            

Download fasta file
RegulonDB