RegulonDB RegulonDB 10.9: Gene Sequence
ygeA gene sequence


Size: 693        A: 159  T: 181  G: 205  C: 148

Fasta

 

>ygeA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacaattggtttgctgggaggaatgagctgggaatccaccattccttactatcgt
ttgataaatgaaggcattaaacagcggcttggtgggcttcactctgcgcaagtgctgcta
catagcgtcgattttcatgaaatagaagagtgccagcgtcgcggggaatgggataaaacc
ggggacattctggctgaggcggcgcttggcttacagcgggcgggcgcagaaggtattgtg
ctatgtaccaatacgatgcataaagtggcggatgccattgagtcacgttgcactctgcct
ttcttacacattgcggatgccaccggacgtgcaattaccggggccggaatgactcgtgtg
gcgctgctgggtacgcgttacaccatggaacaggatttttatcgcgggcggctgacggaa
caattttccatcaattgtcttattcctgaagcggatgaacgggcgaaaattaatcagatt
atttttgaagaactgtgtctggggcaatttaccgaagcgtcacgcgcttattgtgcgcaa
gtgattgctcgccttgcagaacagggcgcacagggcgtcatttttggctgcacagaaatt
ggtttactggtgccagaagagcgcagtgttttgcctgtgtttgataccgcggcgatccat
gccgaggatgctgtcgcttttatgctgtcgtag
              
                            

Download fasta file
RegulonDB