RegulonDB RegulonDB 10.9: Gene Sequence
fau gene sequence


Size: 549        A: 127  T: 137  G: 148  C: 137

Fasta

 

>fau E. coli K12. Version NC_000913.3 GI:556503834
atgattcggcaacgtcgtcgtgcgttaacgccggaacaacagcaggaaatgggtcaacaa
gccgctacccggatgatgacttatcccccggtggtgatggcacatacggtcgctgtattc
ctctcttttgatggcgaactcgacacccagccactcatagaacaactctggcgcgccggt
aagcgcgtatatcttccagttttgcatccctttagtgccggtaatttgctgttcctgaat
taccatccgcaaagcgaactggtgatgaacaggttgaagatccatgagccaaaattggat
gtgcgtgacgtgctacccctttcccgattagacgtgctgatcacaccgctggtcgccttt
gatgagtacggtcagcgcctgggaatgggcggtggtttttatgatcggaccttacaaaac
tggcagcactataaaacgcaaccggtgggttatgcgcatgattgtcagttggtggaaaaa
ctccccgttgaagagtgggatatccctcttcctgcggtggttacaccgtcgaaagtctgg
gagtggtaa
              
                            

Download fasta file
RegulonDB