RegulonDB RegulonDB 10.9: Gene Sequence
ygiB gene sequence


Size: 672        A: 172  T: 123  G: 184  C: 193

Fasta

 

>ygiB E. coli K12. Version NC_000913.3 GI:556503834
atgaaacggacaaaatccatacgccacgcatcgttccgcaaaaactggagcgcacgccat
ctgacaccagtcgctctcgcggttgccactgtttttatgctggctggctgtgaaaagagt
gatgaaacagtgtctctctatcaaaatgctgacgactgttcagctgcaaacccaggcaaa
agcgccgaatgtaccaccgcgtacaacaatgcgctgaaagaagccgaacgtactgcgccg
aaatacgccacccgtgaagactgtgttgctgaatttggtgaaggtcagtgccagcaggca
ccagcccaggctggcatggcaccagaaaaccaggcgcaggcccagcaatccagcgggagt
ttctggatgccgctgatggccggttacatgatggggcgtctgatgggcggcggcgcggga
tttgcacagcagccgctgttctcctcgaaaaacccagccagtccggcttacggtaaatat
accgacgcgacgggtaaaaactatggcgcagcccagccaggccgcaccatgaccgtaccg
aagacggcaatggcaccaaaaccggcgaccaccactaccgttacccgtggcggttttggt
gaatctgttgccaaacaaagcactatgcagcgtagtgcaaccggtacctcttctcgttca
atgggtggctga
              
                            

Download fasta file
RegulonDB