RegulonDB RegulonDB 10.9: Gene Sequence
garK gene sequence


Size: 1146        A: 273  T: 257  G: 361  C: 255

Fasta

 

>garK E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatcgtaatcgccccagactcttataaagaaagtttatctgccagcgaggttgcg
caggcgatagaaaaaggatttcgggaaatttttcctgatgcacagtacgtttctgttccg
gttgccgacggtggcgaaggaacggtggaagcgatgattgcagccacccagggggctgaa
cgtcacgcctgggttacagggccgctgggcgagaaagtgaatgccagttgggggatctcc
ggcgatggcaaaaccgcgtttattgaaatggcggcggccagtgggctggagctggtacct
gcggaaaaacgcgatccactcgtgaccacttcacgcggcacaggcgagttaatcctgcag
gcgctggagagcggtgcgacaaacattattatcggcattggcggcagcgctacaaatgat
ggcggcgcaggcatggtacaggcgctgggggcgaaattatgcgacgccaacggcaatgaa
attggttttggcggcggtagtcttaatactctgaatgatattgatatttccggcctcgat
ccgcgcttaaaagattgcgtcattcgcgtcgcttgtgatgtcaccaatccgctggtgggc
gataacggcgcatcgcgcatctttggcccacaaaagggagccagtgaagcgatgattgtt
gagctggacaataacctctctcactatgccgaggtcattaaaaaagcgctgcatgttgat
gtgaaagatgtccccggtgcaggagctgcgggtggtatgggcgcggcgctaatggcgttt
cttggtgcggaactgaaaagtggtattgaaatcgtcactacggcgctgaatctggaggaa
catattcacgattgtacgctggtgatcaccggtgaagggcgtattgacagccagagtatt
cacgggaaggtaccgattggtgtcgcaaacgtggcgaagaagtaccataaaccggtgatt
ggcattgcgggtagcctgaccgatgatgttggcgttgtacatcagcatggcattgatgcg
gtcttcagcgtattgaccagcataggtacgttggacgaagcattccgcggggcttatgac
aatatctgccgtgcttcacgtaatatcgccgcgacactggcgattggaatgcgcaacgcg
gggtga
              
                            

Download fasta file
RegulonDB