RegulonDB RegulonDB 10.8: Gene Sequence
truB gene sequence


Size: 945        A: 221  T: 228  G: 265  C: 231

Fasta

 

>truB E. coli K12. Version NC_000913.3 GI:556503834
atgagtcgtcctcgtcgtcgcggtcgcgacattaacggcgttttgttgctggataaacct
cagggtatgtccagcaacgatgcgctgcaaaaagtgaaacgtatatataacgccaaccgt
gccgggcataccggtgcgctggacccgctggcgaccggcatgttgccgatttgcctcggg
gaagcgacgaagttttcccagtatctgctggactccgacaaacgctatcgggtcattgcg
cgtcttggacagcgtaccgatacttctgatgccgacggacagatcgttgaagaacgtccg
gtaacctttagcgcagagcagctggcagcggcactggatactttccgtggcgatatcgaa
cagatcccttcgatgtattcagcactgaaatatcagggcaaaaaactgtacgaatatgcg
cgtcagggcattgaagttccgcgtgaagcgcgtccgattaccgtttatgaattgctgttt
attcgccatgaaggcaatgagctggagctggaaattcactgctcaaaaggcacttatatc
cgcaccatcattgatgacctgggtgaaaaactcggctgtggcgcgcatgttatttacctg
cgccgtctggcggtaagtaaatatccggttgaacggatggtgaccctggagcacctgcgt
gaacttgttgagcaagctgaacagcaggatattccagccgcggagttacttgatccatta
ctgatgccaatggacagtccagcttcggactatccggtggtgaatcttccgttaacgtct
tctgtttacttcaaaaatggtaacccggttcgtacatctggtgcgccactggaaggactg
gttcgcgtcacggaaggtgagaacggcaaatttatcggtatgggcgaaattgacgatgaa
ggccgcgttgcgcctcgtcgcctggtggttgaatacccggcgtaa
              
                            

Download fasta file
RegulonDB