RegulonDB RegulonDB 10.9: Gene Sequence
rbfA gene sequence


Size: 402        A: 107  T: 82  G: 113  C: 100

Fasta

 

>rbfA E. coli K12. Version NC_000913.3 GI:556503834
atggcgaaagaatttggtcgcccgcagcgcgtagcgcaggaaatgcaaaaagagatcgct
ctcatcctgcagcgtgaaattaaagatcctcgcctgggcatgatgaccaccgtttccggt
gtcgaaatgtctcgcgacctggcgtatgccaaagtatatgtgacgttcctcaacgacaaa
gatgaagacgcggttaaagcgggcatcaaagcgttgcaagaagcttctggtttcatccgc
agcctgctggggaaagcgatgcgcctgcgtatcgtgccggaactgaccttcttctacgac
aactctctggttgaagggatgcgcatgtcaaacctggtgaccagcgtggtcaaacatgac
gaagaacgtcgtgttaacccggacgacagcaaggaggactaa
              
                            

Download fasta file
RegulonDB