RegulonDB RegulonDB 11.1: Gene Sequence
mioC gene sequence


Size: 444        A: 120  T: 102  G: 113  C: 109

Fasta

 

>mioC E. coli K12. Version NC_000913.3 GI:556503834
atggcagatatcactcttatcagcggcagcaccctcggcggtgccgaatatgtagcagaa
cacctggctgaaaagctggaagaggcgggttttaccaccgaaacgctgcacggtccgctg
ttagaagatttacctgcctcagggatctggctggttatcagctccacccacggtgccgga
gatattccggacaacctttctcctttctatgaagcattgcaggaacagaagcccgatctt
tctgcagtccgctttggcgcaatcggtattggcagtcgtgaatatgacaccttttgtggg
gctatcgataaactcgaggcagaactcaaaaattccggtgcaaaacagacaggcgaaaca
ctgaagatcaacattcttgatcacgacattccggaagatccggcagaagaatggctggga
tcgtgggttaatttactcaaataa
              
                            

Download fasta file
RegulonDB