RegulonDB RegulonDB 10.9: Gene Sequence
creA gene sequence


Size: 474        A: 122  T: 120  G: 130  C: 102

Fasta

 

>creA E. coli K12. Version NC_000913.3 GI:556503834
atgaaatacaagcatttgatcctgtctttaagcctgataatgctggggccattggctcat
gcagaagagattggttcggtcgacaccgtatttaaaatgatcggcccggatcacaaaatt
gttgtggaagcctttgatgatcccgatgtgaaaaatgtcacctgttatgtgagccgggcg
aaaaccggtggtattaaagggggattgggtctggcggaagatacctccgatgcggccatt
tcttgtcagcaagtcgggccgattgaactgtcggatcgtattaaaaacggcaaagctcag
ggcgaggtagtattcaaaaaacgcacgtccctggtctttaagtcgttacaggtcgtgcgc
ttttatgatgccaaacgcaacgcgctcgcttatctggcttactccgacaaagttgtagaa
ggttcgccgaaaaacgcgattagcgcggttcctgtcatgccgtggcggcaataa
              
                            

Download fasta file
RegulonDB