RegulonDB RegulonDB 10.9: Gene Sequence
creB gene sequence


Size: 690        A: 146  T: 163  G: 202  C: 179

Fasta

 

>creB E. coli K12. Version NC_000913.3 GI:556503834
atgcaacgggaaacggtctggttagtggaagatgagcaagggatagccgacacgctggtc
tacatgttgcagcaggaaggttttgccgtcgaggtctttgagcgaggcttgccggtgctg
gataaagctcgcaagcaggtacccgacgtcatgattctcgatgttggtctgccggatatt
agcggctttgaattgtgccgccagttactggcgctccatccggcgttacctgtactgttc
ctgacggcccgaagtgaagaggtcgatcgcctgcttgggctggaaattggtgctgacgac
tacgtggctaaaccgttttcaccccgcgaagtgtgcgccagggtgcgcaccttactgcgt
cgggtgaagaagttctcgacgccgtctcccgtcatccgtattggacattttgaattgaat
gaacccgcggcgcagatcagctggtttgacacgccattagcgctgactcggtatgagttt
ttattgttgaagacgttactcaagtcaccgggccgcgtctggtcccgccagcaactgatg
gatagcgtatgggaagatgcgcaggacacctacgatcgcaccgtcgatacccacattaaa
acgctgcgtgccaagctgcgcgccatcaaccccgatctttcaccgattaatactcatcgc
ggcatgggatatagcctgaggggcctgtaa
              
                            

Download fasta file
RegulonDB