RegulonDB RegulonDB 10.9: Gene Sequence
alkA gene sequence


Size: 849        A: 178  T: 199  G: 272  C: 200

Fasta

 

>alkA E. coli K12. Version NC_000913.3 GI:556503834
atgtataccctgaactggcagccgccgtatgactggtcgtggatgttgggatttctcgcc
gcccgtgcggtgagcagtgtggaaacggtcgcggacagttattatgcccgtagtctggcg
gtgggcgaatatcgcggcgtggtgactgctattccggatatagcccgccatactctgcac
ataaatttaagtgcaggtttagaacctgttgccgcagagtgtctggcgaaaatgagccgc
ctgtttgatctgcaatgtaacccacaaattgttaacggtgcgttgggcaggttaggcgcg
gcgcggcccggattgcgtttacccggctgtgttgatgcttttgagcagggcgtgcgggcg
attttaggccaactggtgagcgtggcgatggcggcaaaattgaccgccagagtggcacag
ctttatggcgaacggctggatgattttccggagtatatctgcttcccgacgcctcagcgg
ctggcagcagcagacccgcaggcattaaaagcgttaggtatgccgttgaaacgggcagag
gcgctgattcatctggcaaatgcggcgctggagggcaccttaccaatgacaataccgggc
gatgtggagcaggcgatgaaaacgctgcaaacttttccgggtatcgggcgctggacggcg
aattattttgctttgcgtggctggcaggcgaaagatgttttcctgccggatgattatctg
attaaacagcgatttccgggaatgacaccggcgcaaatccgccgttatgccgagcgctgg
aagccctggcgttcttatgcgctgttgcatatctggtatacggaaggctggcaaccagac
gaagcatga
              
                            

Download fasta file
RegulonDB