RegulonDB RegulonDB 10.9: Gene Sequence
fliO gene sequence


Size: 366        A: 78  T: 88  G: 102  C: 98

Fasta

 

>fliO E. coli K12. Version NC_000913.3 GI:556503834
atgaataaccacgctactgtgcaatcttccgcgccggtttctgctgcgccactgctgcag
gtgagcggcgcactcatcgccattattgccctgatcctcgctgctgcctggctggtaaaa
cggttgggatttgcccctaaacgcactggcgttaacggtctgaaaattagcgccagtgct
tcactgggcgcgcgtgaaagggttgtggtggtcgatgtggaagatgcacggctggtgctc
ggcgttaccgcaggtcaaatcaatctgctgcataaacttcccccttctgcaccaacggaa
gagataccgcagaccgattttcagtcggtcatgaaaaatttgcttaagcgtagcgggaga
tcctga
              
                            

Download fasta file
RegulonDB