RegulonDB RegulonDB 10.9: Gene Sequence
dcuA gene sequence


Size: 1302        A: 254  T: 363  G: 332  C: 353

Fasta

 

>dcuA E. coli K12. Version NC_000913.3 GI:556503834
atgctagttgtagaactcatcatagttttgctggcgatcttcttgggcgccagattgggg
ggaataggtattggttttgcaggcggattgggggtgctggttcttgccgctattggcgtt
aaacccggtaacatcccgttcgatgtcatctccattatcatggcggttatcgccgctatt
tctgccatgcaggttgctggcggtctggactatctggttcatcagacagaaaagctgctg
cgccgtaacccgaaatacatcacgatcctcgcaccgatcgtgacctatttcctgactatc
tttgctggtactggcaacatctctctggcgacactgccagttatcgctgaagttgcgaag
gaacaaggcgttaaaccttgccgtccgctgtctactgcagtggtatccgcgcagattgcg
atcaccgcatcgccaatctcagcggcagtggtttacatgtcttccgtgatggaaggtcat
ggcatcagctacctccatctgctctccgtggtcatcccgtccaccctgctggcggttctg
gtgatgtccttcctggtcactatgctgttcaactccaaactctctgacgatccgatttat
cgcaagcgtctggaagagggcctggttgaactgcgcggtgaaaagcagattgaaatcaaa
tccggtgcaaaaacgtccgtctggctgttcctgctgggcgtagttggcgtggttatctat
gcaatcatcaacagcccaagcatgggtctggttgaaaaaccgctgatgaacaccaccaac
gcaatcctgatcatcatgctcagcgttgcaactctgaccaccgttatctgtaaagtcgat
accgacaacatcctcaactccagcaccttcaaagcaggtatgagcgcctgtatttgtatc
ctgggtgttgcgtggctgggcgatactttcgtttccaacaacatcgactggatcaaagat
accgctggtgaagtgattcagggtcatccgtggctgctggccgtcatcttcttctttgct
tctgctctgctgtactctcaggctgcaaccgcaaaagcactgatgccgatggctctggca
ctgaacgtttcaccgctgaccgctgttgcttctttcgctgcggtgtctggtctgttcatt
ctgccgacctacccgacgctggttgctgcggtacagatggatgacacgggtactacccgt
atcggtaaattcgtcttcaaccatccgttcttcatcccgggtactctgggtgttgccctg
gccgtttgcttcggcttcgtgctgggtagcttcatgctgtaa
              
                            

Download fasta file
RegulonDB