RegulonDB RegulonDB 10.10: Gene Sequence
leuA gene sequence


Size: 1572        A: 411  T: 328  G: 422  C: 411

Fasta

 

>leuA E. coli K12. Version NC_000913.3 GI:556503834
atgagccagcaagtcattattttcgataccacattgcgcgacggtgaacaggcgttacag
gcaagcttgagtgtgaaagaaaaactgcaaattgcgctggcccttgagcgtatgggtgtt
gacgtgatggaagtcggtttccccgtctcttcgccgggcgattttgaatcggtgcaaacc
atcgcccgccaggttaaaaacagccgcgtatgtgcgttagctcgctgcgtggaaaaagat
atcgacgtggcggccgaatccctgaaagtcgccgaagccttccgtattcatacctttatt
gccacttcgccaatgcacatcgccaccaagctgcgcagcacgctggacgaggtgatcgaa
cgcgctatctatatggtgaaacgcgcccgtaattacaccgatgatgttgaattttcttgc
gaagatgccgggcgtacacccattgccgatctggcgcgagtggtcgaagcggcgattaat
gccggtgccaccaccatcaacattccggacaccgtgggctacaccatgccgtttgagttc
gccggaatcatcagcggcctgtatgaacgcgtgcctaacatcgacaaagccattatctcc
gtacatacccacgacgatttgggcctggcggtcggaaactcactggcggcggtacatgcc
ggtgcacgccaggtggaaggcgcaatgaacgggatcggcgagcgtgccggaaactgttcc
ctggaagaagtcatcatggcgatcaaagttcgtaaggatattctcaacgtccacaccgcc
attaatcaccaggagatatggcgcaccagccagttagttagccagatttgtaatatgccg
atcccggcaaacaaagccattgttggcagcggcgcattcgcacactcctccggtatacac
caggatggcgtgctgaaaaaccgcgaaaactacgaaatcatgacaccagaatctattggt
ctgaaccaaatccagctgaatctgacctctcgttcggggcgtgcggcggtgaaacatcgc
atggatgagatggggtataaagaaagtgaatataatttagacaatttgtacgatgctttc
ctgaagctggcggacaaaaaaggtcaggtgtttgattacgatctggaggcgctggccttc
atcggtaagcagcaagaagagccggagcatttccgtctggattacttcagcgtgcagtct
ggctctaacgatatcgccaccgccgccgtcaaactggcctgtggcgaagaagtcaaagca
gaagccgccaacggtaacggtccggtcgatgccgtctatcaggcaattaaccgcatcact
gaatataacgtcgaactggtgaaatacagcctgaccgccaaaggccacggtaaagatgcg
ctgggtcaggtggatatcgtcgctaactacaacggtcgccgcttccacggcgtcggcctg
gctaccgatattgtcgagtcatctgccaaagccatggtgcacgttctgaacaatatctgg
cgtgccgcagaagtcgaaaaagagttgcaacgcaaagctcaacacaacgaaaacaacaag
gaaaccgtgtga
              
                            

Download fasta file
RegulonDB