RegulonDB RegulonDB 10.8: Gene Sequence
pdeL gene sequence


Size: 1089        A: 294  T: 295  G: 269  C: 231

Fasta

 

>pdeL E. coli K12. Version NC_000913.3 GI:556503834
atgaattcatgtgattttcgtgtttttctgcaagagttcggtacaacggttcatttgtca
ttgcctggtagcgtatccgagaaagaacgactgctactcaagctgctgatgcagggaatg
tctgtaacagaaatatcacagtacagaaatcgcagtgcaaagacaatttcacatcaaaag
aaacagctctttgagaaactggggattcagagcgatattactttctggcgcgatattttc
tttcagtacaatccggagatcatatccgccacggggagtaatagtcacagatatattaat
gataatcactatcaccatatcgtcacgcctgaagccatcagtctggcgttggaaaaccac
gaattcaaaccgtggatccaaccggttttctgcgcgcagactggcgtactgacgggctgt
gaggtgcttgtccgctgggaacatccacaaacgggaattatcccaccggatcagtttatt
cctctggcggagtcatccggtcttattgtcataatgacccgccaactgatgaaacagact
gcggatattctgatgccggtaaaacatttgctgccggacaatttccatattggcatcaac
gtctcggcgggttgttttttggcagcgggatttgaaaaagagtgtctgaacctggttaat
aaattaggtaacgataaaatcaagctggttctcgagctaacggaacgtaaccctattccg
gtaacgccagaagccagagcgatatttgacagccttcatcagcacaacattacctttgcg
ctggatgactttggtacgggttatgcgacctatcgttacttgcaggcgttcccggtcgat
tttattaagatcgataagtcatttgtgcaaatggcgagtgtcgacgaaatctccggtcat
attgtggacaatattgtcgaactagcgcgtaagcctggtctgagtatcgtggcggaaggg
gtagaaacccaggagcaggcggatttaatgatcggtaaaggcgttcactttttgcagggc
tatttgtactctccgccagtaccgggtaataaatttatctctgaatgggtaatgaaagca
ggtggttga
              
                            

Download fasta file
RegulonDB