RegulonDB RegulonDB 10.9: Gene Sequence
ybhA gene sequence


Size: 819        A: 207  T: 190  G: 209  C: 213

Fasta

 

>ybhA E. coli K12. Version NC_000913.3 GI:556503834
atgaccacacgcgtgattgctctcgacttagacggcaccttattgaccccgaaaaagacc
ctgcttccttcatcgatagaagccctggcccgcgctcgcgaagcaggctatcaattaatc
atcgtcacaggtcgccatcacgtcgctattcatcctttttatcaggcgctggcgctggat
acacctgctatttgctgtaatggcacctatttgtatgattatcatgcaaaaaccgtgctg
gaagcggacccaatgcccgttattaaagccctgcaactcattgagatgctgaatgaacac
cacattcacggtctgatgtatgtcgatgatgcaatggtctatgagcacccgaccgggcat
gtcattcgcacatctaactgggcgcaaaccctgccgccggaacagcgtccgactttcaca
caagtcgcttctctggctgaaacggcgcaacaagttaacgccgtatggaagttcgccctg
acgcacgatgacctgccgcaattgcagcattttggtaagcatgtcgaacatgaactggga
ctggagtgtgaatggtcctggcacgatcaggttgatattgcacgcggcggcaacagcaaa
ggtaaacgtttgacgaaatgggttgaggcgcaaggttggtcgatggaaaacgtcgtggca
ttcggcgataactttaatgatatcagtatgctggaagccgctggtacaggcgtggcgatg
ggcaacgccgatgacgcggtaaaagcgcgcgccaacattgtgattggtgataacaccacc
gacagcattgcccagttcatttatagccacctgatttaa
              
                            

Download fasta file
RegulonDB