RegulonDB RegulonDB 11.1: Gene Sequence
ychA gene sequence


Size: 810        A: 213  T: 221  G: 210  C: 166

Fasta

 

>ychA E. coli K12. Version NC_000913.3 GI:556503834
atgagatcgttagctgatttcgaatttaataaagcgccattgtgcgaaggcatgatcctg
gcttgcgaagcaatccgccgcgattttccctcgcaagatgtttacgacgaactggagcgt
ctcgttagtctggcgaaggaagaaatcagccagcttctgcctttagaagagcagttggaa
aaactgatcgcgctgttttacggcgactggggatttaaagcctcacgcggtgtttatcgt
ctttccgatgcattatggctggaccaggtgttaaagaatcgacagggcagtgcggtatca
ttaggtgcggttttattatgggtcgcgaatcgtctcgatttgccgctgctgccggtgatt
ttccctacgcagctgatattgcgcattgaatgtccggatggcgaaatttggctgattaat
ccttttaacggtgaatcgttaagcgaacatatgctggacgtatggttaaagggaaatatc
agcccgtcggcggaactgttttatgaagaccttgatgaagctgataacattgaggtaatc
cgcaaattgctggatacactcaaagcctcgttgatggaagaaaatcagatggagctggcg
ttacgcaccagcgaagctttattacaattcaaccctgaagatccctatgaaattcgcgat
cgcgggttgatttatgcgcaactggattgcgaacacgttgcgttgaacgatttaagttat
ttcgttgaacagtgtccggaagacccgatcagcgaaatgatccgtgcgcaaataaataac
atcgcgcataaacatattgtgctgcattaa
              
                            

Download fasta file
RegulonDB