RegulonDB RegulonDB 10.9: Gene Sequence
mukE gene sequence


Size: 705        A: 174  T: 167  G: 189  C: 175

Fasta

 

>mukE E. coli K12. Version NC_000913.3 GI:556503834
atgtcatcgacaaatattgaacaagtgatgccggttaagctggcgcaggcgctggcgaat
ccgttatttccggcgctggacagcgccttacgttcaggacgccatattggcctcgacgaa
ctggataatcatgcattcctgatggattttcaggaatatctggaagagttttacgcgcgt
tataacgttgagcttattcgcgcaccagaagggttcttctatttacgcccacgttccacc
acgctgatccctcgttccgtcttgtcggaactggatatgatggtcgggaaaatcctctgt
tatctctatctcagcccggaacggctggcgaatgaggggattttcacccagcaggaactg
tacgacgaactgctcaccctggccgatgaagcaaaactgctgaaactggtgaacaaccgt
tcaaccggttcagacgttgaccgtcagaagttgcaggagaaagtacgttcttcgctcaac
cgtctgcgtcgtttaggcatggtgtggtttatgggccacgacagcagcaagtttcgcatt
accgaatcggtgttccgcttcggagccgatgtgcgtgctggcgacgatccccgtgaagca
cagcgtcgcctgattcgtgatggcgaagcaatgccgattgaaaatcatctgcaactcaac
gatgaaaccgaagagaatcagccagatagcggagaggaagaataa
              
                            

Download fasta file
RegulonDB