RegulonDB RegulonDB 10.9: Gene Sequence
ldtD gene sequence


Size: 1848        A: 451  T: 415  G: 501  C: 481

Fasta

 

>ldtD E. coli K12. Version NC_000913.3 GI:556503834
atgttgcttaatatgatgtgtggtcgtcagctgtcggcaatcagtttgtgcctggccgta
acattcgctccactgttcaatgcgcaggccgatgagcctgaagtaatccctggcgacagc
ccggtggctgtcagtgaacagggcgaggcactgccgcaggcgcaagccacggcaataatg
gcggggatccagccattgcctgaaggtgcggcagaaaaagcccgcacgcaaatcgaatct
caattacccgcaggttacaagccggtttatcttaaccagcttcaactgttgtatgccgca
cgcgatatgcaacccatgtgggaaaaccgtgatgctgttaaagccttccagcaacagctg
gcagaggtggcgattgccggtttccagccgcagtttaataaatgggtagagttactgacc
gatcctggtgttaacgggatggcacgcgacgtggtgctctctgatgcgatgatgggctat
ctccatttcattgcaaatattccggtcaaaggcactcgctggctatatagcagtaaacct
tatgcacttgcaacgccgccgctctcggtgattaaccaatggcagctggcgctggataaa
ggtcaattgcctacgtttgttgcaggactggcaccgcagcatccgcaatatgcggcgatg
catgaatcgttactggccttactctgtgacaccaaaccgtggccccaactgaccggcaaa
gcaacgttgcgcccagggcagtggagtaacgacgtaccggcgttgcgcgaaatattgcaa
cgcacaggcatgttggacggggggccgaaaattactctacctggcgatgacacgccaact
gacgcggtagtcagcccatccgctgttactgttgaaacagcagaaactaagccgatggat
aagcaaacgacgtctcgtagtaaacctgcgcctgccgttcgcgccgcctacgataatgaa
ctggtggaagccgttaaacgttttcaggcatggcaaggattgggggcagatggtgctatt
ggcccggcaacacgtgactggttaaacgtaacgcccgcccagcgtgctggtgtgttggct
ctcaacatccagcgattgcgcttgctgccaacagagctttctaccgggatcatggttaac
attccggcctattcgctggtctactatcagaacggcaatcaggtgctggattcgcgagtc
attgtcggtcgccccgatcgcaaaacgccgatgatgagcagtgcccttaacaacgtagtg
gtaaacccgccgtggaacgtacctccaactctggcacgcaaagatattctgccaaaagtg
cgcaacgatccgggatatctcgaaagccatggctatacggtgatgcgcggctggaacagc
agagaagcgattgacccatggcaggttgactggtctacaatcacggcctcgaatttaccg
ttccgcttccagcaggctccaggcccacggaactcgctggggcgctataaattcaatatg
ccgagttcagaggccatttatttgcatgacacgccgaaccacaatctgttcaagcgtgat
acacgcgcattgagctcaggctgtgtacgagtgaataaagcttccgatctggcgaatatg
ctgttgcaggatgcaggctggaatgacaaacgtatttctgatgcgctgaagcagggtgat
acacgttacgtcaatattcggcagtcgattccggtgaatctctactacctgacggccttt
gttggtgcagatggtcgtacccagtatcgtacagatatttacaattatgatctgcctgcg
cgatccagctcgcaaatcgtatcgaaagcggaacaattaatcaggtaa
              
                            

Download fasta file
RegulonDB