RegulonDB RegulonDB 10.9: Gene Sequence
rlmH gene sequence


Size: 468        A: 102  T: 93  G: 144  C: 129

Fasta

 

>rlmH E. coli K12. Version NC_000913.3 GI:556503834
gtgaagctgcaacttgtcgccgtgggaacgaaaatgccggactgggtacaaaccggtttt
accgagtacctgcgtcgttttccgaaagatatgcccttcgagctgattgaaattccggcc
ggaaaacgcggcaagaatgcggacatcaagcgcatactcgacaaagagggtgagcagatg
ttggcggccgcaggcaaaaaccgcattgtcaccctcgatattccaggcaagccctgggat
acgccgcagttagccgctgagctggaacgctggaagctggatggtcgcgacgtcagtcta
ctgattggcgggcctgaagggttgtcgcctgcctgtaaagcggcggctgagcagagctgg
tcgctgtcggcgcttaccctcccccatccgctggttcgcgtgctggtcgcagagagtctg
taccgggcgtggagcatcaccaccaaccatccttatcaccgtgagtga
              
                            

Download fasta file
RegulonDB