RegulonDB RegulonDB 10.9: Gene Sequence
rsfS gene sequence


Size: 318        A: 78  T: 77  G: 89  C: 74

Fasta

 

>rsfS E. coli K12. Version NC_000913.3 GI:556503834
ttgcagggtaaagcactccaggattttgttatcgacaaaattgatgacctcaaaggtcag
gacatcatcgccttagacgttcagggcaaatccagcatcaccgactgcatgatcatctgt
acgggtacgtccagccgtcatgttatgtccattgctgaccacgttgtgcaggagtctcgc
gcagcgggcctgttaccgctcggcgtagaaggtgaaaacagcgccgactggattgtcgtg
gatttgggcgatgtgattgtccatgtcatgcaggaagagagccgtcgcctgtatgaactg
gaaaaactctggagttaa
              
                            

Download fasta file
RegulonDB