RegulonDB RegulonDB 10.9: Gene Sequence
iraP gene sequence


Size: 261        A: 79  T: 61  G: 71  C: 50

Fasta

 

>iraP E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaatctcattgctgagttgttatttaagcttgcccaaaaagaagaagagtcgaaa
gaactgtgtgcgcaggtagaagctttggagattatcgtcactgcaatgcttcgcaatatg
gcgcaaaatgaccaacagcggttgattgatcaggtagagggggcgctgtacgaggtaaag
cccgatgccagcattcctgacgacgatacggagctgctgcgcgattacgtaaagaagtta
ttgaagcatcctcgtcagtaa
              
                            

Download fasta file
RegulonDB