RegulonDB RegulonDB 10.9: Gene Sequence
dgcC gene sequence


Size: 1116        A: 244  T: 273  G: 328  C: 271

Fasta

 

>dgcC E. coli K12. Version NC_000913.3 GI:556503834
atgttcccaaaaataatgaatgatgaaaactttttcaaaaaagcggcggcgcacggggag
gaacctcctttaactcctcaaaacgaacatcagcggtccgggctgcgcttcgcccgtcgc
gtcagactaccccgtgcggttggcctggctggcatgttcttaccgattgcttcaacgctg
gtttcacacccgccgccgggctggtggtggctggtgttggtcggctgggcgttcgtctgg
ccgcatttagcctggcagatagcgagcagggccgtcgatccgcttagccgggaaatttac
aacttaaaaaccgatgcagtattagcgggaatgtgggtaggcgtaatgggcgtaaacgtg
ctgccttccaccgcgatgttgatgattatgtgtctgaatttgatgggggcaggcggcccc
cgtctgtttgtcgcgggtctggtgttgatggtggtttcctgccttgtcaccctcgagctg
acgggcattaccgtgtcgttcaatagtgcgccgctggaatggtggctctcccttcccatt
attgtcatttatcctctgctgtttggctgggtcagctaccagacggcaaccaaactggcg
gaacataaacgcaggttgcaggtcatgagtacccgcgacggcatgacgggcgtgtataac
cgacgtcattgggaaactatgttacgcaatgaatttgataactgtcggcggcataatcgc
gatgcaacgttactgattatcgatatcgaccatttcaagagcatcaacgatacctggggc
catgatgtgggcgatgaagcgattgtggcgcttacccgacagttacaaattaccctgcgc
ggtagcgatgtgattggtcggtttggcggcgatgagtttgcagtaatcatgtccggtacg
ccagctgagagcgccattaccgccatgttacgggtgcatgaagggctaaatacattacgt
ttgccgaatacgccacaggtaactttacggattagtgtgggggttgcgccgctgaaccca
caaatgagtcactatcgtgagtggttgaaatcggcagatttggcgctttacaaagcaaag
aaagccggacgtaaccgcaccgaagtggcggcctga
              
                            

Download fasta file
RegulonDB