RegulonDB RegulonDB 10.9: Gene Sequence
nfsA gene sequence


Size: 723        A: 171  T: 172  G: 197  C: 183

Fasta

 

>nfsA E. coli K12. Version NC_000913.3 GI:556503834
atgacgccaaccattgaacttatttgtggccatcgctccattcgccatttcactgatgaa
cccatttccgaagcgcagcgtgaggcgattattaacagcgcccgtgcgacgtccagttcc
agttttttgcagtgcagtagcattattcgcattaccgacaaagcgttacgtgaagaactg
gtgacgctgaccggcgggcaaaaacacgtagcgcaagcggcggagttctgggtgttctgt
gccgactttaaccgccatttacagatctgtccggatgctcagctcggcctggcggaacaa
ctgttgctcggtgtcgttgatacggcaatgatggcgcagaatgcattaatcgcagcggaa
tcgctgggattgggcggggtatatatcggcggcctgcgcaataatattgaagcggtgacg
aaactgcttaaattaccgcagcatgttctgccgctgtttgggctgtgccttggctggcct
gcggataatccggatcttaagccgcgtttaccggcctccattttggtgcatgaaaacagc
tatcaaccgctggataaaggcgcactggcgcagtatgacgagcaactggcggaatattac
ctcacccgtggcagcaataatcgccgggatacctggagcgatcatatccgccgaacaatc
attaaagaaagccgcccatttattctggattatttgcacaaacagggttgggcgacgcgc
taa
              
                            

Download fasta file
RegulonDB