RegulonDB RegulonDB 10.9: Gene Sequence
cmk gene sequence


Size: 684        A: 157  T: 160  G: 198  C: 169

Fasta

 

>cmk E. coli K12. Version NC_000913.3 GI:556503834
atgacggcaattgccccggttattaccattgatggcccaagcggtgcagggaaaggcacc
ttgtgtaaggctatggcggaagcgttgcaatggcatctgctggactcgggtgcaatttat
cgcgtactggcattggcggcattacatcaccatgttgatgttgcgtcggaagatgcgctg
gtaccgctggcatcccatctggatgtacgttttgtgtcgaccaatggcaatctggaagtg
atcctcgaaggggaagatgtcagcggcgaaattcgtactcaggaagtggcgaatgcagct
tcacaagtcgcggcattcccacgcgttcgtgaagcattattgcgtcgccaacgcgcgttt
cgcgaattaccaggtctgattgccgatggccgcgacatgggaacggtggtattccctgat
gcaccagtgaaaattttccttgacgcctcctcggaagaacgtgcgcatcgccgcatgcta
cagttgcaggagaagggctttagtgttaactttgagcgccttttggccgagatcaaagaa
cgcgacgaccgcgatcgtaaccgagcggtagcgccactggttccggcagccgatgcttta
gtgttggattccaccaccttaagcattgagcaagtgattgaaaaagcgctacaatacgcg
cgccagaaattggctctcgcataa
              
                            

Download fasta file
RegulonDB