RegulonDB RegulonDB 10.9: Gene Sequence
pheL gene sequence


Size: 48        A: 10  T: 20  G: 4  C: 14

Fasta

 

>pheL E. coli K12. Version NC_000913.3 GI:556503834
atgaaacacataccgtttttcttcgcattcttttttaccttcccctga
              
                            

Download fasta file
RegulonDB