RegulonDB RegulonDB 11.1: Gene Sequence
fruL gene sequence


Size: 87        A: 25  T: 23  G: 21  C: 18

Fasta

 

>fruL E. coli K12. Version NC_000913.3 GI:556503834
atgcgcaatttacagcccaacatgtcacgttgggctttttttgcgaaatcagtgggaacc
tggaataaaagcagttgccgcagttaa
              
                            

Download fasta file
RegulonDB