RegulonDB RegulonDB 10.9: Gene Sequence
trpL gene sequence


Size: 45        A: 12  T: 13  G: 12  C: 8

Fasta

 

>trpL E. coli K12. Version NC_000913.3 GI:556503834
atgaaagcaattttcgtactgaaaggttggtggcgcacttcctga
              
                            

Download fasta file
RegulonDB