RegulonDB RegulonDB 10.10: Gene Sequence
ivbL gene sequence


Size: 99        A: 19  T: 22  G: 28  C: 30

Fasta

 

>ivbL E. coli K12. Version NC_000913.3 GI:556503834
atgactacttccatgctcaacgcaaaactactaccaactgcgccatccgccgcagtggtc
gtcgtgcgtgtggtggtggtcgtcggcaatgcgccgtag
              
                            

Download fasta file
RegulonDB