RegulonDB RegulonDB 10.9: Gene Sequence
tnaC gene sequence


Size: 75        A: 26  T: 23  G: 11  C: 15

Fasta

 

>tnaC E. coli K12. Version NC_000913.3 GI:556503834
atgaatatcttacatatatgtgtgacctcaaaatggttcaatattgacaacaaaattgtc
gatcaccgcccttga
              
                            

Download fasta file
RegulonDB