RegulonDB RegulonDB 10.8: Gene Sequence
thrL gene sequence


Size: 66        A: 21  T: 11  G: 12  C: 22

Fasta

 

>thrL E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgcattagcaccaccattaccaccaccatcaccattaccacaggtaacggtgcg
ggctga
              
                            

Download fasta file
RegulonDB