RegulonDB RegulonDB 11.1: Gene Sequence
leuL gene sequence


Size: 87        A: 21  T: 25  G: 18  C: 23

Fasta

 

>leuL E. coli K12. Version NC_000913.3 GI:556503834
atgactcacatcgttcgctttatcggtctactactactaaacgcatcttctttgcgcggt
agacgagtgagcggcatccagcattaa
              
                            

Download fasta file
RegulonDB