RegulonDB RegulonDB 10.9: Gene Sequence
preA gene sequence


Size: 1236        A: 304  T: 301  G: 361  C: 270

Fasta

 

>preA E. coli K12. Version NC_000913.3 GI:556503834
atgttaacgaaagatctttcgattactttttgcggcgtgaagtttcccaacccgttctgc
ctctcttcttcgccggtaggcaactgctatgagatgtgtgccaaagcctacgacacaggt
tggggcggtgtggtgtttaaaacgatcggcttttttatcgccaacgaagtctcgccgcgt
tttgatcatctggtgaaagaagataccggttttatcggcttcaaaaatatggagcagatt
gctgaacatccgttggaagagaatctggccgccctgcgtcggctgaaggaagattacccg
gacaaagtattgatcgcttcgatcatgggggaaaatgagcagcaatgggaggagctggcg
cgcctggtgcaagaagctggcgcggatatgatcgagtgtaacttctcctgtccgcaaatg
acttctcatgcgatgggtagcgatgtcgggcaaagcccggagctggtagaaaaatattgt
cgggcagtgaaacggggttccacgctgccaatgctggcgaagatgacgccgaatatcggt
gatatgtgcgaagtggcgctggcggcgaagcgcggcggcgcagatggcattgcggcgatt
aacaccgttaaatccatcaccaatatcgatcttaatcagaaaatcggtatgccgatcgtt
aacggaaaatcgagtatttccggatattccggtaaagcggtaaaaccgatcgccctgcgc
ttcattcagcaaatgcgcacccatccagaactgcgcgatttcccaatcagcggtatcggc
ggcattgaaacctgggaggatgcggctgagtttttattgctcggcgcagcaacgttacag
gtgaccaccggcatcatgcagtacgggtatcggatagtggaagatatggcaagcgggttg
tcgcattatctcgccgatcagggatttgattcgctgcaggagatggtaggtctggcgaat
aacaatattgtcccggcggaagatttagaccgcagttatattgtctatccccgtatcaat
cttgataaatgtgttggctgtggacgctgttatatttcctgttacgacggcggtcaccag
gcgatggaatggagcgagaaaacccgcacaccgcattgtaataccgagaaatgtgtgggt
tgtctgctttgtggtcacgtctgcccggtgggttgtattgagctcggggaagtgaagttt
aagaaaggcgagaaagaacacccggtaacgttgtaa
              
                            

Download fasta file
RegulonDB