RegulonDB RegulonDB 10.9: Gene Sequence
yeiB gene sequence


Size: 1158        A: 195  T: 333  G: 346  C: 284

Fasta

 

>yeiB E. coli K12. Version NC_000913.3 GI:556503834
atggagcgcaacgtcacgctcgattttgttcgcggcgtcgccattctggggatcctgcta
ttaaacatcagcgcctttgggctaccaaaggcggcttatctcaatcccgcctggtacggt
gctattacgccgcgggatgcatggacttgggcatttcttgatctcatcggccaggtgaaa
ttcctcacgctttttgcgctactgtttggtgcgggcctgcaaatgttgctgccccgtggc
agacgctggatccagtcgcggttaacgctgttagtcttgttgggctttattcacggttta
ttgttctgggacggcgatattttgctggcttacgggctggtgggcttaatctgctggcgg
ctggtgcgcgatgcgccatcggtaaaaagcctgtttaatacaggcgtcatgctttatctg
gtggggcttggcgttttgctgttattggggctgatttccgacagccagaccagccgcgcc
tggacgccggatgcatcggctattttgtatgaaaaatactggaagcttcacggcggcgtt
gaagcgatcagtaatcgtgccgatggtgttggcaacagtttactggcactgggcgcacag
tatggctggcaactggcagggatgatgctcattggtgcggcgctgatgcgcagcggctgg
ctgaaagggcagttcagcttacgtcactatcgtcgtactggttttgtgctggtggcgatt
ggggtgaccattaaccttcctgccatcgccctgcaatggcagctggactgggcgtatcgc
tggtgtgccttcttacttcaaatgccgcgggaactgagtgcgccgtttcaggcgattggc
tatgcgtcgctgttttatggcttctggccgcaattgagccgctttaagctggtgcttgcg
atcgcctgcgtcggacggatggcgctgaccaactatctattgcaaacgctgatttgtacc
acgcttttttaccacctcggtttgtttatgcattttgaccgcctggagctgctggcgttt
gttattccggtatggctggcgaatatcctcttctctgttatctggctgcgttacttccgc
caggggccggtggaatggctctggcgtcagttaactttgcgtgctgccggaccggcaata
tctaaaacatcaagataa
              
                            

Download fasta file
RegulonDB