RegulonDB RegulonDB 10.9: Gene Sequence
ydfA gene sequence


Size: 156        A: 49  T: 32  G: 39  C: 36

Fasta

 

>ydfA E. coli K12. Version NC_000913.3 GI:556503834
atggatactatcgatcttggcaacaacgaatctctggtgtacggcgtgtttccaaaccag
gacggcacgttcaccgcaatgacgtataccaaaagcaaaacgtttaaaaccgaaaatggt
gcccgtcgctggctggaaagaaactcaggtgagtga
              
                            

Download fasta file
RegulonDB