RegulonDB RegulonDB 10.9: Gene Sequence
ydfB gene sequence


Size: 129        A: 40  T: 29  G: 32  C: 28

Fasta

 

>ydfB E. coli K12. Version NC_000913.3 GI:556503834
atggatttcgacacaatcatggaaaaggcttacgaagaatacttcgaaggccttgccgaa
ggcgaagaagctctcagcttcagtgagtttaaacaggcgctttccagttcggcaaaatct
aacggctga
              
                            

Download fasta file
RegulonDB