RegulonDB RegulonDB 10.9: Gene Sequence
ydfC gene sequence


Size: 219        A: 71  T: 43  G: 56  C: 49

Fasta

 

>ydfC E. coli K12. Version NC_000913.3 GI:556503834
atgcagaaacgagaacccgtcatcatcgcgccagactataccgatgatgaactttatgag
tggatgcgccagaaaattaatgcagcgcaggatctgaaatgggctaatgaagccagggct
aagcaggctgaaaatctgtccgctctggagcaggatatcaccaatctggaaaaagcagcg
gcattaagcattgccagaatgattacatacccgcgttag
              
                            

Download fasta file
RegulonDB