RegulonDB RegulonDB 10.9: Gene Sequence
ydfE gene sequence


Size: 921        A: 257  T: 206  G: 241  C: 217

Fasta

 

>ydfE E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaagtctttatttgcgccgctattcctgacgaactggcaacaagggaagaaggc
gctgtggctgtagccacagccattgaagctggcgacgaacgccgtgctcgagcaaaattt
cactggcaattcctggaacattatccggctgctcaggactgcgcttataaatttattgtc
tgcgaggataaacctggcataccccgccctgccctcgattcatgggatgctgaatatatg
caggaaaaccgctgggatgaggagtctgcttcttttgtcccggttgagactgaatccgat
ccgatgaacgtcacttttgacaagctggcccctgaagtacagaacgctgtcatggttaag
ttcgacacatgtgaaaacatcaccgttgatatggttattagcgcacaggaattgttgcag
gaagacatggcaacattcgacggacatatcgttgaagcgttgatgaaaatgccagaagtt
aacgccatgtatccggagcttaagttgcacgccattgggtgggttaagcataaatgtatt
cctggtgctaaatggcccgaaattcaggcagagatgcgcatctggaaaaaacgtcgcgaa
ggtgaacgcaaggaaaccggaaaatacacgtctgttgttgatctcgcccgcgccagagcc
aatcaacagtacactgaaaattcaacaggaaaaatcagcccggtcattgctgccattcat
cgcgaatacaagcagacatggaaaacactggatgacgaactggcctatgggcgctgcttc
gcagacaggcagaacttgatggtatgcctgcgatcaatgccaaacgtgtttaccggatca
tgcgccagaatgcgctgttgcttgagcgaaaacctgctgtaccgccatcgaaacgggcac
atacaggcagagtggccgtga
              
                            

Download fasta file
RegulonDB