RegulonDB RegulonDB 10.9: Gene Sequence
lipA gene sequence


Size: 966        A: 232  T: 218  G: 263  C: 253

Fasta

 

>lipA E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaacccattgtgatggaacgcggtgttaaataccgcgatgccgataagatggcc
cttatcccggttaaaaacgtggcaacagagcgcgaagccctgctgcgcaagccggaatgg
atgaaaatcaagcttccagcggactctacacgtatccagggcatcaaagccgcaatgcgc
aaaaatggcctgcattctgtctgcgaggaagcctcctgccctaacctggcggaatgcttc
aaccacggcacagcaacgtttatgatcctcggcgctatttgtacccgccgttgtccgttc
tgtgatgttgcccacggtcgcccggtagctcctgatgccaatgaaccagtgaaactggcg
cagaccattgccgatatggcgctgcgttatgtggttatcacctccgttgaccgtgatgac
ctgcgcgatggcggtgcccagcactttgcggattgcattactgccattcgggaaaaaagc
ccgcaaatcaaaattgaaactctggtgccggatttccgcggtcgtatggatcgtgctctg
gatattctgactgcaacgccaccagatgtgttcaaccataacctggaaaacgtaccgcgt
atttaccgtcaggtacggcctggtgcagattacaactggtcgctgaagctgctggaacgc
tttaaagaagcgcatccggaaatcccgaccaagtctggtctgatggtgggactgggtgaa
accaatgaagaaattattgaggtaatgcgcgacctgcgccgtcatggtgtgacgatgtta
acgctggggcaatatttgcagccaagccgccatcacctgccggttcaacgttacgttagc
ccggatgagttcgacgaaatgaaagccgaagcgctggcgatgggctttacccatgctgca
tgcggtccgtttgtccgctcttcttaccacgccgatttgcaggcgaaagggatggaagtt
aagtaa
              
                            

Download fasta file
RegulonDB