RegulonDB RegulonDB 10.9: Gene Sequence
pdxI gene sequence


Size: 861        A: 192  T: 212  G: 242  C: 215

Fasta

 

>pdxI E. coli K12. Version NC_000913.3 GI:556503834
atgagcagcaatacatttactctcggtacaaaatccgttaaccgtcttggttatggcgcg
atgcaactggcaggtcctggagtttttggccccccacgagatcgccacgtcgctataacc
gtgctgcgtgaggcgctggcattgggcgtcaatcatattgataccagcgacttttatggt
ccgcacgtcaccaatcagattatccgcgaagcgctttatccttactctgacgacctgaca
attgtcactaaaattggtgcgcggcgtggagaggacgcatcctggttgcccgcattttct
ccggcagagctgcaaaaagcggtgcacgataatctacgtaatctcgggctggacgtgctg
gatgtggttaacctgcgcgttatgatgggggatggtcatggcccagcggaaggatcgatt
gaggccagcctgaccgtgctggcagagatgcaacaacaaggcctggtaaaacatattggc
ctgagcaacgtcacaccgacgcaggttgcagaggcgcgcaagattgccgaaattgtctgt
gtgcaaaacgaatacaacatcgcgcaccgtgctgatgatgcaatgattgatgctttggcc
cacgatggcattgcctacgtgccgttcttcccgctcgggggctttacaccgctgcaatcg
tccacactttccgatgttgctgcgagcctgggtgcaacaccaatgcaggtggcgctggcg
tggctgttacagcgttcaccgaatattttgctgatcccagggacgtcttcggttgcgcat
ttacgggagaatatggctgctgaaaaattgcatctttctgaggaagtgttgtctacgttg
gatggtatttcgcgagaataa
              
                            

Download fasta file
RegulonDB