RegulonDB RegulonDB 10.9: Gene Sequence
ydbD gene sequence


Size: 2307        A: 666  T: 638  G: 556  C: 447

Fasta

 

>ydbD E. coli K12. Version NC_000913.3 GI:556503834
atgttgaaggccaggaattgcggctggatacgtttactgcccctgtttatgctgagtcta
ccagtacaggcggaacttcgatgtgttgcaaatgcagttgatattgaatcatttttttct
gcggctaccgctgaagataaacaacaagttgaacaagctatcaacagtagcgtgaatctt
gtccccttcggtttatctgcatcgaactggaaagtgcatcgtggcgatttagtggtagaa
ggtaatatagagagtaatcaaaaattgattgttcttgggaatttgacagtcaaaggtaat
atttccactttctctctttctaatccatgggttattctcggtaacgtgacggcaacgaat
atagttgcggattcaccactgttaattaccggttcgataaatgcaagtggactggtattt
atcgactcatattacgataatccgtctacgattaaggggagtattaatgcgcgtgggata
tttatcaatgacataattgcacctgttgttgcgtcttcgacaaatagtgaattcatggtc
cgtgcgagtgacaaacatgacactgaaaatgtcaaaaaagcgctgatgataataaatcct
gatgcatattattgggggctaattaatgatgaagatgctctgaaagaaatttttaagcga
agcaatattcgcatggcagggaatgtctgtaatcagatgaaaaaagaagcgctgtttcgc
cctaagccttctcctgagttagtgcaagaattgcaaatgctggatgaaggcaaagttgct
gcatttgaaggacgagacattgcgacatttgatcttgccgtaatgcgaactctcccaagg
cttaaaggaatttcagctaacctacgcaaacaacttattaatagcaatgatgaacaaacg
attgaaagtatggcgagatatatgcctgacaatgagattctggagttgaccgatcagcaa
ttgggttaccagcctgttgttctggggttgctcgaccgtgaaccgctctctgtcgaaata
atgacgcgaatgagtcgtctacctgatggtgtcggtccgttgaatcttgcgctacgtgaa
aatctccctctggatatcgtcatgactctggcgaaaagagattgggatatgatcattcag
gagctttataaagatgcgtggttattgcctgaatccattattgatggctatatccgcagt
gatgattcctctattcgtcaggtcggtgctggaggacaactcacctacaatcaggcaatg
cagttggcgaacgattcatcaaacaatgttgtcacaagcttagcgttcaagctggcagag
atgaaacaccatggtcaattgttgcggatgacgccacaagagagtgacaaagttgcaggc
tatttataccaaaaattcgagaatgacgatgatctaatacgtgtgttatttttagcattg
ccagataacttacagtttaattttgttaaaaggatggagaaaaaatccccggcctacttt
tgctgtcgggatatgcaggtaattcactctgacgctgctttacaacggttattgacacgt
ttcaacgatcctgaagggtggagtaatctggcgaaaaatcagtatctgagcacgtcgatg
aaacaaaaaatttggcaacgtgctttatcgcatcggaaaaataatccgaaagcagattca
gatgcatatgaaaccagcgctgatatgattttgtctgagctgattagccacggcgaagtt
gatgaccagatgctattaaatgccaccgccctgatacgttcggacgactgggacttttta
gagagtgcattaattagttgggataatttacccgctgttgttctcaaggaattacagcaa
aacacgccacgcaatgatatttgggcgaagttttttctgaggcaggaaaacagttcccgt
gcgcaggttgacgaagcgttacgtgtttattatgcactagaccccgatgcgttagcacaa
ctggatgtactggcaaaacaaccggatcgtatatggtggagtacactggcgaaaagcaat
ctcacatttttcaagttcggcgcacttaacaaccgccacacaccgcctgcagtactggcg
gcagaaattgatcccgagtggtggattgtggcgatgaataatccccgttttccagttgat
gtattaaaggcgaggctgaaacgtgatcctttgctggcgttagagcttgttaaccctgaa
ctggatttagtccgccagctggcgcttaacggtaagacgcgcgcaatacgggaacaagcg
atgagaaaacttgatgagttgtattga
              
                            

Download fasta file
RegulonDB