RegulonDB RegulonDB 10.9: Gene Sequence
dusB gene sequence


Size: 966        A: 239  T: 222  G: 265  C: 240

Fasta

 

>dusB E. coli K12. Version NC_000913.3 GI:556503834
atgcgcatcggacaatatcagctcagaaatcgcctgatcgcagcgcccatggctggcatt
acagacagaccttttcggacgttgtgctacgagatgggagccggattgacagtatccgag
atgatgtcttctaacccacaggtttgggaaagcgacaaatctcgtttacggatggtgcac
attgatgaacccggtattcgcaccgtgcaaattgctggtagcgatccgaaagaaatggca
gatgcagcacgtattaacgtggaaagcggtgcccagattattgatatcaatatgggttgc
ccggctaaaaaagtgaatcgcaagctcgcaggttcagccctcttgcagtacccggatgtc
gttaaatcgatccttaccgaggtcgtcaatgcagtggacgttcctgttaccctgaagatt
cgcaccggctgggcaccggaacaccgtaactgcgaagagattgcccaactggctgaagac
tgtggcattcaggctctgaccattcatggccgtacacgcgcctgtttgttcaatggagaa
gctgagtacgacagtattcgggcagttaagcagaaagtttccattccggttatcgcgaat
ggcgacattactgacccgcttaaagccagagctgtgctcgactatacaggggcggatgcc
ctgatgataggccgcgcagctcagggaagaccctggatctttcgggaaatccagcattat
ctggacactggggagttgctgcccccgctgcctttggcagaggttaagcgcttgctttgc
gcgcacgttcgggaactgcatgacttttatggtccggcaaaagggtaccgaattgcacgt
aaacacgtttcctggtatctccaggaacacgctccaaatgaccagtttcggcgcacattc
aacgccattgaggatgccagcgaacagctggaggcgttggaggcatacttcgaaaatttt
gcgtaa
              
                            

Download fasta file
RegulonDB