RegulonDB RegulonDB 11.0: Gene Sequence
malS gene sequence


Size: 2031        A: 512  T: 446  G: 541  C: 532

Fasta

 

>malS E. coli K12. Version NC_000913.3 GI:556503834
atgaaactcgccgcctgttttctgacactccttcctggcttcgccgttgccgccagctgg
acttctccggggtttcccgcctttagcgaacaggggacaggaacatttgtcagccacgcg
cagttgcccaaaggtacgcgtccactaacgctaaattttgaccaacagtgctggcagcct
gcggatgcgataaaactcaatcagatgctttccctgcaaccttgtagcaacacgccgcct
caatggcgattgttcagggacggcgaatatacgctgcaaatagacacccgctccggtacg
ccaacattgatgatttccatccagaacgccgccgaaccggtagcaagcctggtccgtgaa
tgcccgaaatgggatggattaccgctcacagtggatgtcagcgccactttcccggaagga
gccgccgtacgggattattacagccagcaaattgcgatagtgaagaacggtcaaataatg
ttacaacccgctgccaccagcaacggtttactcctgctggaacgggcagaaactgacaca
tccgcccctttcgactggcataacgccacggtttactttgtgctgacagatcgtttcgaa
aacggcgatcccagtaatgaccagagttacggacgtcataaagacggtatggcggaaatt
ggcacttttcacggcggcgatttacgcggcctgaccaacaaactggattacctccagcag
ttgggcgttaatgctttatggataagcgccccatttgagcaaattcacggctgggtcggc
ggcggtacaaaaggcgatttcccgcattatgcctaccacggttattacacacaggactgg
acgaatcttgatgccaatatgggcaacgaagccgatctacggacgctggttgatagcgca
catcagcgcggtattcgtattctctttgatgtcgtgatgaaccacaccggctatgccacg
ctggcggatatgcaggagtatcagtttggcgcgttatatctttctggtgacgaagtgaaa
aaatcgctgggtgaacgctggagcgactggaaacctgccgccgggcaaacctggcatagc
tttaacgattacattaatttcagcgacaaaacaggctgggataaatggtggggaaaaaac
tggatcagaacggatatcggcgattacgacaatcctggattcgacgatctcactatgtcg
ctagcctttttgccggatatcaaaaccgaatcaactaccgcttctggtctgccggtgttc
tataaaaacaaaatggatacccacgccaaagccattgacggctatacgccgcgcgattac
ttaacccactggttaagtcagtgggtccgcgactatgggattgatggttttcgggtcgat
accgccaaacatgttgagttgcccgcctggcagcaactgaaaaccgaagccagcgccgcg
cttcgcgaatggaaaaaagctaaccccgacaaagcattagatgacaaacctttctggatg
accggtgaagcctggggccacggcgtgatgcaaagtgactactatcgccacggcttcgat
gcgatgatcaatttcgattatcaggagcaggcggcgaaagcagtcgactgtctggcgcag
atggatacgacctggcagcaaatggcggagaaattgcagggtttcaacgtgttgagctac
ctctcgtcgcatgatacccgcctgttccgtgaagggggcgacaaagcagcagagttatta
ctattagcgccaggcgcggtacaaatcttttatggtgatgaatcctcgcgtccgttcggt
cctacaggttctgatccgctgcaaggtacacgttcggatatgaactggcaggatgttagc
ggtaaatctgccgccagcgtcgcgcactggcagaaaatcagccagttccgcgcccgccat
cccgcaattggcgcgggcaaacaaacgacacttttgctgaagcagggctacggctttgtt
cgtgagcatggcgacgataaagtgctggtcgtctgggcagggcaacagtaa
              
                            

Download fasta file
RegulonDB